Chapter 19 & 20 Test Hints
This is a bit detailed. I hope it helps. Good luck on the test!
Chapter 19
The Structure of Chromatin
Know what a histone is.
Know what a nucleosome is.
Know the order of complexity of the packing of DNA into chromatin, i.e. nucleosome, 30-nm chromatin fiber, etc. Know figure 19.1
Repetitive DNA
All you need to know about Repetitive DNA is here. If you want to review it in more detail see your book pages 346-348.
Realize that most of our DNA, 97%, does not code for proteins! Much of this non-coding DNA consists of repetitive DNA. This repetitive DNA comes in two flavors:
1. Tandem Repetitive DNA (AKA Satellite DNA)
•A DNA sequence that repeats itself in series- one after another.
•The sequences can be long (100,000- 10,000,000 base pairs), medium length (100- 100,00 base pairs), short (10-100 base pairs).
•These sequences can repeat up to 100,000 times!!!
Example:
Suppose this is a short sequence: “ATCGGCCTTAGC”
To be a tandem repeat it repeats itself again and again, one after another, as follows (I have made the first base pair bold so you can identify the beginning of the repeated sequence:
ATCGGCCTTAGCATCGGCCTTAGCATCGGCCTTAGCATCGGCCTTAGC
2. Interspersed Repetitive DNA
•A DNA sequence that repeats but not next to itself, i.e. it is “interspersed” throughout the genome.
•Alu elements are a famous “family” of interspersed repetitive DNA. Alu elements are about 300 base pairs long and are found scattered throughout the genome. They make up 10% of our genome (more than our actual genes!), are transcribed into mRNA, and have no known function. . . yet!
Know the basics of multigene families and pseudogenes.
Chapter 20
You need to know three main things from this chapter:
1. How to clone human genes in a bacterial plasmid. See pages 364-369. Figs 20.1, 20.2, 20.3.
2. How to do PCR. See page 371 and this website.
•I HIGHLY recommend visiting the website to visualize PCR. It has a great animation and will definitely increase your understanding of the process. You will need to download a Shockwave plug-in to view the animation.
3. How to do gel electrophoresis.
A few extra guidelines. . .
With regards to cloning human genes in a bacterial plasmid, make sure you know the following:
Know what restriction endonucleases are and how they are used in biotechnology.
Know what a “sticky end” is.
Know that ECO RI and BAM HI are the names of two of the more commonly used restriction endonucleases.
Know the function of DNA ligase.
Think about what problems might be encountered when attempting to get a bacteria to express eukaryotic DNA. They both have the same genetic code but prokaryotic DNA is not exactly like eukaryotic DNA, now is it?
Know what is meant by “cloning vector”.
Understand the importance of how bacterial plasmids are used in biotechnology.
With regards to the Polymerase Chain Reaction (PCR), make sure you know the following:
Know the different ingredients you mix together before you place the PCR tube in the thermocycler.
Be able to explain the purpose and function of each of the ingredients.
Know the function of the thermocycler. Why bother with this very expensive machine?
Free Response Question hint:
You will either be expected to explain how the Polymerase Chain Reaction (PCR) is done (words and illustrations), or how to clone a human gene in a bacterial plasmid (words and illustrations). The written description will be most important, but a well labeled illustration will garner some points as well. Be able to explain why we do PCR and/or gene cloning. Be able to give a real-life example of each.
Some terminology:
Know that the word anneal means to "attach"- for DNA to pair by hydrogen bonds to a complementary sequence. The opposite of anneal is denature.
High heat causes the double-stranded DNA to denature, i.e. the two complementary strands separate from one another. Cooling the solution allows the complementary DNA strands to anneal with one another.
A Final Reflection on the Meaning of the Word “Clone”.
The word “clone” simply means making an identical “copy”. So, when we say something is “cloned” we are saying something is “copied”. Therefore, the word clone can refer to many kinds of “copying” that occur in biotechnology applications. The common use of the term is when we say an organism is “cloned”. This type of cloning is what resulted in Dolly, the first cloned mammal. It is also known as “reproductive cloning”- good reporters will use this terminology in their reporting. This is what might someday happen with humans- making a “copy” or “clone” of a person.
Scientists can also “clone” genes. This is generally done using bacterial plasmids. A gene of interest is isolated and extracted from some organism- the organism does not need to be a prokaryote- it can be a eukaryote like you and me. Think for a minute about why this is possible- it is very cool. . . Prokaryotes and eukaryotes all share a common ancestor- the genetic code that evolved in that very early ancestor, billions of years ago, was inherited by all its descendants- you, me, and the E.Coli bacteria living in our intestine! Since we all share this same genetic code, all organisms can read the code and therefore make the same proteins. Therefore human genes can be inserted into bacteria, and then these bacteria can make human proteins! They can literally become human protein factories. In fact the very first commercial use of this technology was in 1982 when Genentech, a biotech company in San Francisco, received FDA approval to have E.Coli bacteria manufacture human insulin. This made diabetics very happy for it was the first time in history they could actually inject real human insulin into themselves, even though it was made by a bacteria!